Journal: American Journal of Physiology - Cell Physiology
Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin
doi: 10.1152/ajpcell.00036.2015
Figure Lengend Snippet: Upregulation of ASIC-1 membrane expression by cell adhesion to fibronectin requires integrin-β1. A and C: stable D54MG cell lines β1-KD and β1-Scr were transfected with ASIC-1-GFP. After 72 h, cells were incubated on fibronectin-coated dishes or on uncoated plates for 24 h; then total, as well as biotinylated, surface proteins were immunoblotted for GFP and integrin-β1. No increase in plasma membrane expression of ASIC-1 was observed in β1-KD cells with fibronectin-mediated cell adhesion (n ≥ 3). In contrast, a significant increase (n ≥ 3) in membrane localization of ASIC-1, as well as integrin-β1, after fibronectin-mediated integrin activation was observed in β1-Scr cells (C). p27KIP1 was used as a loading control and to demonstrate lack of biotinylation of intracellular proteins. B and D: normalized densitometry of membrane ASIC-1, integrin-β1, and Na+-K+-ATPase in D54MG β1-KD and β1-Scr cells transfected with ASIC-1-GFP and incubated on fibronectin-coated dishes or on uncoated plates for 24 h. ***P < 0.001.
Article Snippet: HuSH 29mer short hairpin (shRNA) kits providing vector control, scrambled negative control, and four target variants (OriGene, Rockville, MD) were used to downregulate integrin-β 1 (TG320392: locus ID 3688; GAAGGAATGCCTACTTCTGCACGATGTGA), α-actinin-1 (TF314970: locus ID 87; CTCATCTTCGACAACAAGCACACCAACTA), and α-actinin-4 (TG314967: locus ID 81; GAGCACCTGATGGAGGACTACGAGAAGCT).
Techniques: Expressing, Transfection, Incubation, Activation Assay