Review

integrin beta 1 shrna (Santa Cruz Biotechnology)

Name: integrin beta 1 shrna
Brand: Santa Cruz Biotechnology
Rating: 93 (11 reviews)

Santa Cruz Biotechnology is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Santa Cruz Biotechnology integrin beta 1 shrna
Integrin Beta 1 Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/integrin beta 1 shrna/product/Santa Cruz Biotechnology
Average 93 stars, based on 11 article reviews

integrin beta 1 shrna - by Bioz Stars, 2026-03

93/100 stars

Images

Image Search Results

Physical association of acid-sensing ion channel (ASIC)-1 with integrin-β1 in glioma cells. A: cell lysates were immunoprecipitated (IP) with mouse anti-integrin-β1 (β1) antibody and immunoblotted (IB) with rabbit anti-ASIC-1. Immunoprecipitation of integrin-β1 pulled down ASIC-1 at ∼70 kDa. Lysate refers to total lysate (25 μg of protein) prepared from cells. B: immunoprecipitation of ASIC-1 using rabbit anti-ASIC-1 from D54MG cell lysates pulled down integrin-β1 detected by mouse anti-integrin-β1 at ∼130 kDa. C: in D54MG cells stably overexpressing GFP-tagged ASIC-1 (D54MG_A1GFP), immunoprecipitation of integrin-β1 pulled down GFP-ASIC-1 consistent with the expected size of GFP-tagged ASIC-1 at ∼100 kDa. Nonimmune rabbit IgG and mouse IgG did not immunoprecipitate any specific bands (n ≥ 3). D: ASIC-1 and integrin-β1 also coprecipitated from 3 additional glioma cell lines (U87, U251, and U373).

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Physical association of acid-sensing ion channel (ASIC)-1 with integrin-β1 in glioma cells. A: cell lysates were immunoprecipitated (IP) with mouse anti-integrin-β1 (β1) antibody and immunoblotted (IB) with rabbit anti-ASIC-1. Immunoprecipitation of integrin-β1 pulled down ASIC-1 at ∼70 kDa. Lysate refers to total lysate (25 μg of protein) prepared from cells. B: immunoprecipitation of ASIC-1 using rabbit anti-ASIC-1 from D54MG cell lysates pulled down integrin-β1 detected by mouse anti-integrin-β1 at ∼130 kDa. C: in D54MG cells stably overexpressing GFP-tagged ASIC-1 (D54MG_A1GFP), immunoprecipitation of integrin-β1 pulled down GFP-ASIC-1 consistent with the expected size of GFP-tagged ASIC-1 at ∼100 kDa. Nonimmune rabbit IgG and mouse IgG did not immunoprecipitate any specific bands (n ≥ 3). D: ASIC-1 and integrin-β1 also coprecipitated from 3 additional glioma cell lines (U87, U251, and U373).

Article Snippet: HuSH 29mer short hairpin (shRNA) kits providing vector control, scrambled negative control, and four target variants (OriGene, Rockville, MD) were used to downregulate integrin-β 1 (TG320392: locus ID 3688; GAAGGAATGCCTACTTCTGCACGATGTGA), α-actinin-1 (TF314970: locus ID 87; CTCATCTTCGACAACAAGCACACCAACTA), and α-actinin-4 (TG314967: locus ID 81; GAGCACCTGATGGAGGACTACGAGAAGCT).

Techniques: Immunoprecipitation, Stable Transfection

Knockdown of integrin-β1 in glioma cells. A: lysates from untransfected wild-type (WT) D54MG cells and D54MG cells stably transfected with shRNA for integrin-β1 [knockdown (KD)], scrambled shRNA (Scr), or empty vector (EV). Expression of integrin-β1 was significantly decreased in KD cells compared with WT cells (n ≥ 4). B: expression of integrin-β1 in 3 additional glioma cell lines (U87, U251, and U373) was also significantly reduced by shRNA. ***P < 0.001 by ANOVA and Dunnett's post hoc test (A) and Student's t-test (B).

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Knockdown of integrin-β1 in glioma cells. A: lysates from untransfected wild-type (WT) D54MG cells and D54MG cells stably transfected with shRNA for integrin-β1 [knockdown (KD)], scrambled shRNA (Scr), or empty vector (EV). Expression of integrin-β1 was significantly decreased in KD cells compared with WT cells (n ≥ 4). B: expression of integrin-β1 in 3 additional glioma cell lines (U87, U251, and U373) was also significantly reduced by shRNA. ***P < 0.001 by ANOVA and Dunnett's post hoc test (A) and Student's t-test (B).

Techniques: Stable Transfection, Transfection, shRNA, Plasmid Preparation, Expressing

Knockdown of integrin-β1 inhibits amiloride-sensitive current in glioma cells. A: current-voltage relationships show significant attenuation of amiloride-sensitive whole cell current after knockdown of integrin-β1 (n ≥ 6). B: average amiloride-sensitive conductance in D54MG cells. C: current-voltage relationships recorded from U87MG cells transfected with shRNA targeting integrin-β1. D: average amiloride-sensitive conductance in U87MG cells. **P < 0.01; ***P < 0.001 by ANOVA and Dunnett's post hoc test.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Knockdown of integrin-β1 inhibits amiloride-sensitive current in glioma cells. A: current-voltage relationships show significant attenuation of amiloride-sensitive whole cell current after knockdown of integrin-β1 (n ≥ 6). B: average amiloride-sensitive conductance in D54MG cells. C: current-voltage relationships recorded from U87MG cells transfected with shRNA targeting integrin-β1. D: average amiloride-sensitive conductance in U87MG cells. **P < 0.01; ***P < 0.001 by ANOVA and Dunnett's post hoc test.

Techniques: Transfection, shRNA

$Surface expression of ASIC-1 requires integrin-β1. A: after surface biotinylation, lysates (10 μg) and the surface fraction from D54MG cells in which integrin-β1 was knocked down (KD) and control (Scr) cells (transfected with ASIC-1-GFP) were analyzed. Membrane expression of ASIC-1 was significantly inhibited in KD cells compared with Scr cells, but there was no significant change in total expression of ASIC-1 (n ≥ 4). B and C: normalized densitometry of surface ASIC-1 and Na+-K+-ATPase expression in KD and Scr D54MG cells. Blots were stripped and reimmunoblotted for Na+-K+-ATPase and β-actin as a loading control for surface proteins. ***P < 0.001.$

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Surface expression of ASIC-1 requires integrin-β1. A: after surface biotinylation, lysates (10 μg) and the surface fraction from D54MG cells in which integrin-β1 was knocked down (KD) and control (Scr) cells (transfected with ASIC-1-GFP) were analyzed. Membrane expression of ASIC-1 was significantly inhibited in KD cells compared with Scr cells, but there was no significant change in total expression of ASIC-1 (n ≥ 4). B and C: normalized densitometry of surface ASIC-1 and Na+-K+-ATPase expression in KD and Scr D54MG cells. Blots were stripped and reimmunoblotted for Na+-K+-ATPase and β-actin as a loading control for surface proteins. ***P < 0.001.

Techniques: Expressing, Transfection

Cell adhesion through fibronectin increased membrane expression of ASIC-1. A: total and surface proteins were immunoblotted for GFP and integrin-β1 in D54MG cells. Membrane localization of ASIC-1 was significantly increased and total and membrane expression of integrin-β1 was higher following 24 h of incubation on fibronectin (FN)-coated plates (n ≥ 3). B: normalized densitometry of membrane ASIC-1 and integrin-β1 in cells incubated on fibronectin-coated dishes (FN+) or on uncoated plates (FN−) for 24 h. β-Actin was used as a loading control. *P < 0.05; ***P < 0.001.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Cell adhesion through fibronectin increased membrane expression of ASIC-1. A: total and surface proteins were immunoblotted for GFP and integrin-β1 in D54MG cells. Membrane localization of ASIC-1 was significantly increased and total and membrane expression of integrin-β1 was higher following 24 h of incubation on fibronectin (FN)-coated plates (n ≥ 3). B: normalized densitometry of membrane ASIC-1 and integrin-β1 in cells incubated on fibronectin-coated dishes (FN+) or on uncoated plates (FN−) for 24 h. β-Actin was used as a loading control. *P < 0.05; ***P < 0.001.

Techniques: Expressing, Incubation

Upregulation of ASIC-1 membrane expression by cell adhesion to fibronectin requires integrin-β1. A and C: stable D54MG cell lines β1-KD and β1-Scr were transfected with ASIC-1-GFP. After 72 h, cells were incubated on fibronectin-coated dishes or on uncoated plates for 24 h; then total, as well as biotinylated, surface proteins were immunoblotted for GFP and integrin-β1. No increase in plasma membrane expression of ASIC-1 was observed in β1-KD cells with fibronectin-mediated cell adhesion (n ≥ 3). In contrast, a significant increase (n ≥ 3) in membrane localization of ASIC-1, as well as integrin-β1, after fibronectin-mediated integrin activation was observed in β1-Scr cells (C). p27KIP1 was used as a loading control and to demonstrate lack of biotinylation of intracellular proteins. B and D: normalized densitometry of membrane ASIC-1, integrin-β1, and Na+-K+-ATPase in D54MG β1-KD and β1-Scr cells transfected with ASIC-1-GFP and incubated on fibronectin-coated dishes or on uncoated plates for 24 h. ***P < 0.001.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Upregulation of ASIC-1 membrane expression by cell adhesion to fibronectin requires integrin-β1. A and C: stable D54MG cell lines β1-KD and β1-Scr were transfected with ASIC-1-GFP. After 72 h, cells were incubated on fibronectin-coated dishes or on uncoated plates for 24 h; then total, as well as biotinylated, surface proteins were immunoblotted for GFP and integrin-β1. No increase in plasma membrane expression of ASIC-1 was observed in β1-KD cells with fibronectin-mediated cell adhesion (n ≥ 3). In contrast, a significant increase (n ≥ 3) in membrane localization of ASIC-1, as well as integrin-β1, after fibronectin-mediated integrin activation was observed in β1-Scr cells (C). p27KIP1 was used as a loading control and to demonstrate lack of biotinylation of intracellular proteins. B and D: normalized densitometry of membrane ASIC-1, integrin-β1, and Na+-K+-ATPase in D54MG β1-KD and β1-Scr cells transfected with ASIC-1-GFP and incubated on fibronectin-coated dishes or on uncoated plates for 24 h. ***P < 0.001.

Techniques: Expressing, Transfection, Incubation, Activation Assay

Immunoprecipitation of ASIC-1 and integrin-β1 requires α-actinin. A and B: lysates from U87, U251, and U373 cells were immunoprecipitated with antibodies against ASIC-1 and blotted for integrin-β1 and actinin-1 and -4 or precipitated with antibodies against integrin-β1 (Intβ1) and blotted with antibodies against ASIC-1 and actinin-1 and -4. C: D54MG cells [wild-type (D54MG_WT)], stable D54MG cells with truncated ASIC-1 (D54MG_A1DN), and stable D54MG cells with shRNA for integrin-β1 (D54MG_β1KD) were immunoprecipitated with rabbit anti-ASIC-1 or mouse anti-integrin-β1 antibody and blotted with a rabbit pan-anti-α-actinin. Immunoprecipitation of ASIC-1 and integrin-β1 pulled down α-actinin at ∼110 kDa in D54MG cells. Coimmunoprecipitation of ASIC-1 and α-actinin was decreased in D54MG_A1DN cells, and coimmunoprecipitation of α-actinin with integrin-β1 was reduced in D54MG_β1KD cells but coimmunoprecipitation between ASIC-1 and α-actinin was not affected. Lysate refers to total lysate (25 μg of protein) prepared from these cells. Nonimmune rabbit IgG (rIgG) and mouse IgG (mIgG) immunoprecipitation showed specificity of rabbit ASIC-1, mouse integrin-β1, and rabbit α-actinin antibody (n ≥ 3).

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Immunoprecipitation of ASIC-1 and integrin-β1 requires α-actinin. A and B: lysates from U87, U251, and U373 cells were immunoprecipitated with antibodies against ASIC-1 and blotted for integrin-β1 and actinin-1 and -4 or precipitated with antibodies against integrin-β1 (Intβ1) and blotted with antibodies against ASIC-1 and actinin-1 and -4. C: D54MG cells [wild-type (D54MG_WT)], stable D54MG cells with truncated ASIC-1 (D54MG_A1DN), and stable D54MG cells with shRNA for integrin-β1 (D54MG_β1KD) were immunoprecipitated with rabbit anti-ASIC-1 or mouse anti-integrin-β1 antibody and blotted with a rabbit pan-anti-α-actinin. Immunoprecipitation of ASIC-1 and integrin-β1 pulled down α-actinin at ∼110 kDa in D54MG cells. Coimmunoprecipitation of ASIC-1 and α-actinin was decreased in D54MG_A1DN cells, and coimmunoprecipitation of α-actinin with integrin-β1 was reduced in D54MG_β1KD cells but coimmunoprecipitation between ASIC-1 and α-actinin was not affected. Lysate refers to total lysate (25 μg of protein) prepared from these cells. Nonimmune rabbit IgG (rIgG) and mouse IgG (mIgG) immunoprecipitation showed specificity of rabbit ASIC-1, mouse integrin-β1, and rabbit α-actinin antibody (n ≥ 3).

Techniques: Immunoprecipitation, shRNA

Knockdown of α-actinin-1 and -4 reduces amiloride-sensitive current in D54MG cells. A: knockdown of α-actinin-1 and -4 reduces coimmunoprecipitation of ASIC-1 and integrin-β1. B: average amiloride-sensitive conductance of D54MG cells stably transfected with scrambled or knockdown shRNA for α-actinin-1 (A1SC and A1KD, n ≥ 5) and scrambled or knockdown shRNA for α-actinin-4 (A4SC and A4KD, n ≥ 4) at −80 mV. C: current-voltage relationships show significant attenuation of amiloride-sensitive whole cell conductance after knockdown of α-actinin-1 and -4. Knockdown of individual α-actinin-1 or -4 diminished coimmunoprecipitation of ASIC-1 and integrin-β1 compared with individual shRNA with the scrambled sequence (n ≥ 3). *P < 0.05; **P < 0.01 by Student's t-test.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Knockdown of α-actinin-1 and -4 reduces amiloride-sensitive current in D54MG cells. A: knockdown of α-actinin-1 and -4 reduces coimmunoprecipitation of ASIC-1 and integrin-β1. B: average amiloride-sensitive conductance of D54MG cells stably transfected with scrambled or knockdown shRNA for α-actinin-1 (A1SC and A1KD, n ≥ 5) and scrambled or knockdown shRNA for α-actinin-4 (A4SC and A4KD, n ≥ 4) at −80 mV. C: current-voltage relationships show significant attenuation of amiloride-sensitive whole cell conductance after knockdown of α-actinin-1 and -4. Knockdown of individual α-actinin-1 or -4 diminished coimmunoprecipitation of ASIC-1 and integrin-β1 compared with individual shRNA with the scrambled sequence (n ≥ 3). *P < 0.05; **P < 0.01 by Student's t-test.

Techniques: Stable Transfection, Transfection, shRNA, Sequencing

$Surface expression of ASIC-1 also requires α-actinin-1 and -4. A: stable D54MG cell lines α-ACTN 1-KD and α-ACTN 1-Scr were transfected with ASIC-1-GFP; after 72 h of surface biotinylation, lysates (10 μg) and surface fraction from stable D54MG cells transfected with KD and Scr shRNA for α-actinin-1 were analyzed. Membrane expression of ASIC-1 was significantly inhibited in KD cells compared with Scr cells, but there was no significant change in total expression of ASIC-1 (n ≥ 4). Blots were stripped and immunoblotted for integrin-β1 and β-actin. B: membrane expression of ASIC-1 was significantly inhibited in KD cells compared with Scr cells when α-actinin-4 was stably knocked down (n ≥ 4). Normalized densitometry shows membrane ASIC-1 and integrin-β1 in KD and Scr cells. *P < 0.05.$

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Surface expression of ASIC-1 also requires α-actinin-1 and -4. A: stable D54MG cell lines α-ACTN 1-KD and α-ACTN 1-Scr were transfected with ASIC-1-GFP; after 72 h of surface biotinylation, lysates (10 μg) and surface fraction from stable D54MG cells transfected with KD and Scr shRNA for α-actinin-1 were analyzed. Membrane expression of ASIC-1 was significantly inhibited in KD cells compared with Scr cells, but there was no significant change in total expression of ASIC-1 (n ≥ 4). Blots were stripped and immunoblotted for integrin-β1 and β-actin. B: membrane expression of ASIC-1 was significantly inhibited in KD cells compared with Scr cells when α-actinin-4 was stably knocked down (n ≥ 4). Normalized densitometry shows membrane ASIC-1 and integrin-β1 in KD and Scr cells. *P < 0.05.

Techniques: Expressing, Transfection, shRNA, Stable Transfection

Putative binding site for α-actinin on the COOH terminus of ASIC-1 is required for surface expression. A and B: surface expression of ASIC-1 was significantly inhibited in D54MG cells expressing the mutant construct compared with wild-type D54MG cells, while membrane integrin-β1 level was unchanged (n ≥ 4). Blots were stripped and reblotted for integrin-β1 and β-actin. C and D: similar results in U373 cells, where mutation of the COOH terminus of ASIC-1 significantly reduced surface expression of ASIC-1. ***P < 0.001.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Putative binding site for α-actinin on the COOH terminus of ASIC-1 is required for surface expression. A and B: surface expression of ASIC-1 was significantly inhibited in D54MG cells expressing the mutant construct compared with wild-type D54MG cells, while membrane integrin-β1 level was unchanged (n ≥ 4). Blots were stripped and reblotted for integrin-β1 and β-actin. C and D: similar results in U373 cells, where mutation of the COOH terminus of ASIC-1 significantly reduced surface expression of ASIC-1. ***P < 0.001.

Techniques: Binding Assay, Expressing, Mutagenesis, Construct

Deletion of the α-actinin-binding site in ASIC-1 prevents coimmunprecipitation of ASIC-1 and integrin-β1. Immunoprecipitation of lysates from D54MG (A) and U373 (B) cells with antibodies directed against ASIC-1 and immunoblotting for integrin-β1 showed significant inhibition of association of ASIC-1 with integrin-β1 in the mutant cells (n ≥ 4).

Journal: American Journal of Physiology - Cell Physiology

Article Title: Physical and functional interactions between a glioma cation channel and integrin-β 1 require α-actinin

doi: 10.1152/ajpcell.00036.2015

Figure Lengend Snippet: Deletion of the α-actinin-binding site in ASIC-1 prevents coimmunprecipitation of ASIC-1 and integrin-β1. Immunoprecipitation of lysates from D54MG (A) and U373 (B) cells with antibodies directed against ASIC-1 and immunoblotting for integrin-β1 showed significant inhibition of association of ASIC-1 with integrin-β1 in the mutant cells (n ≥ 4).

Techniques: Binding Assay, Immunoprecipitation, Western Blot, Inhibition, Mutagenesis

Review

Structured Review

Images

Similar Products

Image Search Results